Merge pull request #227090 from natsukium/bowtie2/aarch64

{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }:

{ lib

, stdenv

, fetchFromGitHub

, cmake

, perl

, python3

, tbb

, zlib

, runCommand

, bowtie2

}:

stdenv.mkDerivation rec {

stdenv.mkDerivation (finalAttrs: {

  pname = "bowtie2";

  version = "2.5.2";

  src = fetchFromGitHub {

    owner = "BenLangmead";

    repo = pname;

    rev = "v${version}";

    sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0=";

    repo = "bowtie2";

    rev = "refs/tags/v${finalAttrs.version}";

    fetchSubmodules = true;

    hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0=";

  };

  # because of this flag, gcc on aarch64 cannot find the Threads

  # Could NOT find Threads (missing: Threads_FOUND)

  # TODO: check with other distros and report upstream

  postPatch = ''

    substituteInPlace CMakeLists.txt \

      --replace "-m64" ""

  '';

  nativeBuildInputs = [ cmake ];

  buildInputs = [ tbb zlib python3 perl ];

  cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];

  # ctest fails because of missing dependencies between tests

  doCheck = false;

  passthru.tests = {

    ctest = runCommand "${finalAttrs.pname}-test" { } ''

      mkdir $out

      ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10

      ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small

      ${bowtie2}/bin/bowtie2-inspect-s $out/small

      ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large

      ${bowtie2}/bin/bowtie2-inspect-l $out/large

    '';

  };

  meta = with lib; {

    description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";

    license = licenses.gpl3;

    license = licenses.gpl3Plus;

    homepage = "http://bowtie-bio.sf.net/bowtie2";

    changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}";

    maintainers = with maintainers; [ rybern ];

    platforms = platforms.all;

    broken = stdenv.isAarch64; # only x86 is supported

    mainProgram = "bowtie2";

  };

}

})