Unverified Commit 056f9e21 authored by natsukium's avatar natsukium
Browse files

bowtie2: enable tests

parent 13fe1eff

pkgs/applications/science/biology/bowtie2/default.nix

+16 −0
Original line number Diff line number Diff line
@@ -6,6 +6,8 @@ 
, python3

, tbb

, zlib

, runCommand

, bowtie2

}:



stdenv.mkDerivation (finalAttrs: {
@@ -34,6 +36,20 @@ stdenv.mkDerivation (finalAttrs: { 


  cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];



  # ctest fails because of missing dependencies between tests

  doCheck = false;



  passthru.tests = {

    ctest = runCommand "${finalAttrs.pname}-test" { } ''

      mkdir $out

      ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10

      ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small

      ${bowtie2}/bin/bowtie2-inspect-s $out/small

      ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large

      ${bowtie2}/bin/bowtie2-inspect-l $out/large

    '';

  };



  meta = with lib; {

    description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";

    license = licenses.gpl3Plus;