Unverified Commit e5968ce7 authored by github-actions[bot]'s avatar github-actions[bot] Committed by GitHub
Browse files

Merge staging-next into staging

parents 613d6026 1c4183d8
Loading
Loading
Loading
Loading
+1 −1
Original line number Diff line number Diff line
@@ -565,7 +565,7 @@ Names of files and directories should be in lowercase, with dashes between words

- Do not use tab characters, i.e. configure your editor to use soft tabs. For instance, use `(setq-default indent-tabs-mode nil)` in Emacs. Everybody has different tab settings so it’s asking for trouble.

- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [](#sec-package-naming).
- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [package naming](./pkgs/README.md#package-naming).

- Function calls with attribute set arguments are written as

+5 −0
Original line number Diff line number Diff line
@@ -19363,6 +19363,11 @@
    github = "ymeister";
    githubId = 47071325;
  };
  ymstnt = {
    name = "YMSTNT";
    github = "ymstnt";
    githubId = 21342713;
  };
  yoavlavi = {
    email = "yoav@yoavlavi.com";
    github = "yoav-lavi";
+3 −3
Original line number Diff line number Diff line
@@ -103,9 +103,9 @@ in
      };

      bantime = mkOption {
        default = null;
        type = types.nullOr types.str;
        example = "10m";
        default = "10m";
        type = types.str;
        example = "1h";
        description = lib.mdDoc "Number of seconds that a host is banned.";
      };

+44 −8
Original line number Diff line number Diff line
{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }:
{ lib
, stdenv
, fetchFromGitHub
, cmake
, perl
, python3
, tbb
, zlib
, runCommand
, bowtie2
}:

stdenv.mkDerivation rec {
stdenv.mkDerivation (finalAttrs: {
  pname = "bowtie2";
  version = "2.5.2";

  src = fetchFromGitHub {
    owner = "BenLangmead";
    repo = pname;
    rev = "v${version}";
    sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0=";
    repo = "bowtie2";
    rev = "refs/tags/v${finalAttrs.version}";
    fetchSubmodules = true;
    hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0=";
  };

  # because of this flag, gcc on aarch64 cannot find the Threads
  # Could NOT find Threads (missing: Threads_FOUND)
  # TODO: check with other distros and report upstream
  postPatch = ''
    substituteInPlace CMakeLists.txt \
      --replace "-m64" ""
  '';

  nativeBuildInputs = [ cmake ];

  buildInputs = [ tbb zlib python3 perl ];

  cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];

  # ctest fails because of missing dependencies between tests
  doCheck = false;

  passthru.tests = {
    ctest = runCommand "${finalAttrs.pname}-test" { } ''
      mkdir $out
      ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
      ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
      ${bowtie2}/bin/bowtie2-inspect-s $out/small
      ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
      ${bowtie2}/bin/bowtie2-inspect-l $out/large
    '';
  };

  meta = with lib; {
    description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
    license = licenses.gpl3;
    license = licenses.gpl3Plus;
    homepage = "http://bowtie-bio.sf.net/bowtie2";
    changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}";
    maintainers = with maintainers; [ rybern ];
    platforms = platforms.all;
    broken = stdenv.isAarch64; # only x86 is supported
    mainProgram = "bowtie2";
  };
}
})
+41 −0
Original line number Diff line number Diff line
{ lib, appimageTools, fetchurl }:

let
  version = "0.9.9.5";
  pname = "hifile";

  src = fetchurl {
    url = "https://www.hifile.app/files/HiFile-${version}.AppImage";
    hash = "sha256-Ks/NLPm5loo9q8pT0LdtfcrC38203beNE74sbEpyuJM=";
  };

  appimageContents = appimageTools.extractType2 {
    inherit pname version src;
  };

in
appimageTools.wrapType2 rec {
  inherit pname version src;

  extraInstallCommands = ''
    mv $out/bin/${pname}-${version} $out/bin/${pname}

    install -m 444 -D ${appimageContents}/HiFile.desktop $out/share/applications/HiFile.desktop
    install -m 444 -D ${appimageContents}/HiFile.png $out/share/icons/hicolor/512x512/apps/HiFile.png
    substituteInPlace $out/share/applications/HiFile.desktop \
      --replace 'Exec=HiFile' 'Exec=${pname}'
  '';

  meta = with lib; {
    description = "Dual-pane graphical file manager for Windows, macOS and Linux";
    longDescription = ''
      HiFile is the next evolution of file managers. Its mission is to increase your productivity whenever you work with files or folders. It aims to be better in every way - more convenient, more versatile, more efficient, more elegant, more customizable, and more fun.
    '';
    homepage = "https://www.hifile.app/";
    downloadPage = "https://www.hifile.app/download";
    license = licenses.unfree;
    sourceProvenance = with sourceTypes; [ binaryNativeCode ];
    maintainers = with maintainers; [ ymstnt ];
    platforms = [ "x86_64-linux" ];
  };
}
Loading