Merge staging-next into staging

- Do not use tab characters, i.e. configure your editor to use soft tabs. For instance, use `(setq-default indent-tabs-mode nil)` in Emacs. Everybody has different tab settings so it’s asking for trouble.

- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [](#sec-package-naming).

- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [package naming](./pkgs/README.md#package-naming).

- Function calls with attribute set arguments are written as

    github = "ymeister";

    githubId = 47071325;

  };

  ymstnt = {

    name = "YMSTNT";

    github = "ymstnt";

    githubId = 21342713;

  };

  yoavlavi = {

    email = "yoav@yoavlavi.com";

    github = "yoav-lavi";

      };

      bantime = mkOption {

        default = null;

        type = types.nullOr types.str;

        example = "10m";

        default = "10m";

        type = types.str;

        example = "1h";

        description = lib.mdDoc "Number of seconds that a host is banned.";

      };

{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }:

{ lib

, stdenv

, fetchFromGitHub

, cmake

, perl

, python3

, tbb

, zlib

, runCommand

, bowtie2

}:

stdenv.mkDerivation rec {

stdenv.mkDerivation (finalAttrs: {

  pname = "bowtie2";

  version = "2.5.2";

  src = fetchFromGitHub {

    owner = "BenLangmead";

    repo = pname;

    rev = "v${version}";

    sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0=";

    repo = "bowtie2";

    rev = "refs/tags/v${finalAttrs.version}";

    fetchSubmodules = true;

    hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0=";

  };

  # because of this flag, gcc on aarch64 cannot find the Threads

  # Could NOT find Threads (missing: Threads_FOUND)

  # TODO: check with other distros and report upstream

  postPatch = ''

    substituteInPlace CMakeLists.txt \

      --replace "-m64" ""

  '';

  nativeBuildInputs = [ cmake ];

  buildInputs = [ tbb zlib python3 perl ];

  cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];

  # ctest fails because of missing dependencies between tests

  doCheck = false;

  passthru.tests = {

    ctest = runCommand "${finalAttrs.pname}-test" { } ''

      mkdir $out

      ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10

      ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small

      ${bowtie2}/bin/bowtie2-inspect-s $out/small

      ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large

      ${bowtie2}/bin/bowtie2-inspect-l $out/large

    '';

  };

  meta = with lib; {

    description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";

    license = licenses.gpl3;

    license = licenses.gpl3Plus;

    homepage = "http://bowtie-bio.sf.net/bowtie2";

    changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}";

    maintainers = with maintainers; [ rybern ];

    platforms = platforms.all;

    broken = stdenv.isAarch64; # only x86 is supported

    mainProgram = "bowtie2";

  };

}

})

{ lib, appimageTools, fetchurl }:

let

  version = "0.9.9.5";

  pname = "hifile";

  src = fetchurl {

    url = "https://www.hifile.app/files/HiFile-${version}.AppImage";

    hash = "sha256-Ks/NLPm5loo9q8pT0LdtfcrC38203beNE74sbEpyuJM=";

  };

  appimageContents = appimageTools.extractType2 {

    inherit pname version src;

  };

in

appimageTools.wrapType2 rec {

  inherit pname version src;

  extraInstallCommands = ''

    mv $out/bin/${pname}-${version} $out/bin/${pname}

    install -m 444 -D ${appimageContents}/HiFile.desktop $out/share/applications/HiFile.desktop

    install -m 444 -D ${appimageContents}/HiFile.png $out/share/icons/hicolor/512x512/apps/HiFile.png

    substituteInPlace $out/share/applications/HiFile.desktop \

      --replace 'Exec=HiFile' 'Exec=${pname}'

  '';

  meta = with lib; {

    description = "Dual-pane graphical file manager for Windows, macOS and Linux";

    longDescription = ''

      HiFile is the next evolution of file managers. Its mission is to increase your productivity whenever you work with files or folders. It aims to be better in every way - more convenient, more versatile, more efficient, more elegant, more customizable, and more fun.

    '';

    homepage = "https://www.hifile.app/";

    downloadPage = "https://www.hifile.app/download";

    license = licenses.unfree;

    sourceProvenance = with sourceTypes; [ binaryNativeCode ];

    maintainers = with maintainers; [ ymstnt ];

    platforms = [ "x86_64-linux" ];

  };

}